Skip to main content

pcDNA5-FRT/TO-eGFP-msMMS22L
(Plasmid #221014)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 221014 Standard format: Plasmid sent in bacteria as agar stab 1 $89 *

* Log in to view industry pricing.

Backbone

  • Vector backbone
    pcDNA5 eGFP-FRT-T0
  • Backbone manufacturer
    ThermoFisher
  • Backbone size w/o insert (bp) 5825
  • Total vector size (bp) 9539
  • Vector type
    Mammalian Expression
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    MMS22L
  • Alt name
    C16orf167
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    3714
  • Mutation
    naturally siResistant to siMMS22L (human) aagacuugcuguugcgaua
  • Entrez Gene
    Mms22l (a.k.a. F730047E07Rik, Gm134)
  • Promoter CMV
  • Tag / Fusion Protein
    • eGFP (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AscI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer cgcaaatgggcggtaggcgtg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA5-FRT/TO-eGFP-msMMS22L was a gift from Daniel Durocher (Addgene plasmid # 221014 ; http://n2t.net/addgene:221014 ; RRID:Addgene_221014)
  • For your References section:

    The MMS22L-TONSL complex mediates recovery from replication stress and homologous recombination. O'Donnell L, Panier S, Wildenhain J, Tkach JM, Al-Hakim A, Landry MC, Escribano-Diaz C, Szilard RK, Young JT, Munro M, Canny MD, Kolas NK, Zhang W, Harding SM, Ylanko J, Mendez M, Mullin M, Sun T, Habermann B, Datti A, Bristow RG, Gingras AC, Tyers MD, Brown GW, Durocher D. Mol Cell. 2010 Nov 24;40(4):619-31. doi: 10.1016/j.molcel.2010.10.024. Epub 2010 Nov 4. 10.1016/j.molcel.2010.10.024 PubMed 21055983