Skip to main content
Addgene

poly H35S SUMO1
(Plasmid #221071)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 221071 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pMAL
  • Backbone size w/o insert (bp) 6600
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Five repeats of H35S SUMO1 each separated by (GGS)4
  • Species
    H. sapiens (human)
  • Mutation
    H35S
  • Entrez Gene
    SUMO1 (a.k.a. DAP1, GMP1, OFC10, PIC1, SENP2, SMT3, SMT3C, SMT3H3, UBL1)
  • Promoter tac
  • Tags / Fusion Proteins
    • MBP (N terminal on insert)
    • His (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (unknown if destroyed)
  • 3′ cloning site BamHI (unknown if destroyed)
  • 5′ sequencing primer GGTCGTCAGACTGTCGATGAAGCC
  • 3′ sequencing primer TGTCCTACTCAGGAGAGCGTTCAC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Jonggul

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    poly H35S SUMO1 was a gift from Michael Rosen (Addgene plasmid # 221071 ; http://n2t.net/addgene:221071 ; RRID:Addgene_221071)
  • For your References section:

    Surface Charge Can Modulate Phase Separation of Multidomain Proteins. Kim J, Qin S, Zhou HX, Rosen MK. J Am Chem Soc. 2024 Feb 7;146(5):3383-3395. doi: 10.1021/jacs.3c12789. Epub 2024 Jan 23. 10.1021/jacs.3c12789 PubMed 38262618