Skip to main content

CUP1-∆ssCPY*-mGFP in pRS315
(Plasmid #221158)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 221158 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pRS315
  • Backbone size w/o insert (bp) 5925
  • Total vector size (bp) 8895
  • Vector type
    Yeast Expression
  • Selectable markers
    LEU2

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Carboxypeptidase Y
  • Alt name
    ∆ssCPY*
  • Species
    S. cerevisiae (budding yeast)
  • Insert Size (bp)
    1536
  • Mutation
    Deletion signal peptide, G255A mutation
  • GenBank ID
  • Entrez Gene
    PRC1 (a.k.a. YMR297W, CPY1, LBC1)
  • Tag / Fusion Protein
    • mGFP (C terminal on backbone)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer tgtatcaattgcattataatatcttcttgt
  • 3′ sequencing primer aactaattacatgatatcgacaaaggaaaa
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    CUP1-∆ssCPY*-mGFP in pRS315 was a gift from Mark Leake (Addgene plasmid # 221158 ; http://n2t.net/addgene:221158 ; RRID:Addgene_221158)