-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 22133 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepSUPER_Retro-GFP/Neo
-
Backbone manufacturerOligoEngine
- Backbone size w/o insert (bp) 7394
-
Vector typeMammalian Expression, Retroviral, RNAi
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsDH5a or HB101
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesynthethic oligonucleotide
-
Insert Size (bp)58
-
Mutationsynthethic oligonucleotide encoding shRNA targeting Luciferase mRNA
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Bgl II (destroyed during cloning)
- 3′ cloning site Hind III (not destroyed)
- 5′ sequencing primer MSCV reverse
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
shRNA oligo sequence is - 5'-GAGATCCCCCGTACGCGGAATACTTCGATTCAAGAGATCGAAGTATTCCGCGTACGTTTTT
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Luc-pSUPER-Retro-GFP/Neo was a gift from William Kaelin (Addgene plasmid # 22133 ; http://n2t.net/addgene:22133 ; RRID:Addgene_22133) -
For your References section:
Hypoxia-inducible factor linked to differential kidney cancer risk seen with type 2A and type 2B VHL mutations. Li L, Zhang L, Zhang X, Yan Q, Minamishima YA, Olumi AF, Mao M, Bartz S, Kaelin WG. Mol Cell Biol. 2007 Aug . 27(15):5381-92. 10.1128/MCB.00282-07 PubMed 17526729