pCSC-NGN2-IRES-ISL1-T2A-LHX3
(Plasmid
#221814)
-
PurposeLentiviral vector expressing human NEUROG2, ISL1 and LHX3 for inducing pluripotent stem cells into cholinergic motor neurons.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 221814 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneLentiviral vector
- Backbone size w/o insert (bp) 9861
- Total vector size (bp) 12228
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameNEUROG2
-
Alt nameNGN2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2016
-
GenBank IDNM_024019.4
-
Entrez GeneNEUROG2 (a.k.a. Atoh4, Math4A, NGN2, bHLHa8, ngn-2)
- Promoter CMV
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site ClaI (not destroyed)
- 3′ cloning site XbaI (destroyed during cloning)
- 5′ sequencing primer agctcgtttagtgaaccgtcagatc
- 3′ sequencing primer cgtcttttggcaatgtgagg
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameISL1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1158
-
GenBank IDNM_002202.3
-
Entrez GeneISL1 (a.k.a. ISLET1, Isl-1)
Gene/Insert 3
-
Gene/Insert nameLHX3
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1209
-
GenBank IDNM_178138.6
-
Entrez GeneLHX3 (a.k.a. CPHD3, LIM3, M2-LHX3)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCSC-NGN2-IRES-ISL1-T2A-LHX3 was a gift from Baojin Ding (Addgene plasmid # 221814 ; http://n2t.net/addgene:221814 ; RRID:Addgene_221814) -
For your References section:
Generation and optimization of highly pure motor neurons from human induced pluripotent stem cells via lentiviral delivery of transcription factors. Sepehrimanesh M, Ding B. Am J Physiol Cell Physiol. 2020 Oct 1;319(4):C771-C780. doi: 10.1152/ajpcell.00279.2020. Epub 2020 Aug 12. 10.1152/ajpcell.00279.2020 PubMed 32783653