pcDNA5-FRT/T0-Flag-CIP2A
(Plasmid
#222623)
-
Purposemammalian expression vector of Flag-tagged CIP2A
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 222623 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 * | |
* Log in to view industry pricing.
Backbone
-
Vector backbonepcDNA5 Flag-FRT-T0
-
Backbone manufacturerThermoFisher
- Backbone size w/o insert (bp) 5161
- Total vector size (bp) 7877
-
Vector typeMammalian Expression
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCIP2A
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2715
-
Entrez GeneCIP2A (a.k.a. KIAA1524, NOCIVA, p90)
- Promoter CMV
-
Tag
/ Fusion Protein
- Flag (N terminal on insert)
Cloning Information
- Cloning method Other
- 5′ sequencing primer cgcaaatgggcggtaggcgtg
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA5-FRT/T0-Flag-CIP2A was a gift from Daniel Durocher (Addgene plasmid # 222623 ; http://n2t.net/addgene:222623 ; RRID:Addgene_222623) -
For your References section:
The CIP2A-TOPBP1 axis safeguards chromosome stability and is a synthetic lethal target for BRCA-mutated cancer. Adam S, Rossi SE, Moatti N, De Marco Zompit M, Xue Y, Ng TF, Alvarez-Quilon A, Desjardins J, Bhaskaran V, Martino G, Setiaputra D, Noordermeer SM, Ohsumi TK, Hustedt N, Szilard RK, Chaudhary N, Munro M, Veloso A, Melo H, Yin SY, Papp R, Young JTF, Zinda M, Stucki M, Durocher D. Nat Cancer. 2021 Dec;2(12):1357-1371. doi: 10.1038/s43018-021-00266-w. Epub 2021 Nov 11. 10.1038/s43018-021-00266-w PubMed 35121901