HuEx-2xNLS-iGeoCas9(C2)-2xNLS_EGFP-g1
(Plasmid
#222994)
-
PurposeMammalian expression of iGeoCas9(C2) construct with EGFP-targeting sgRNA
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 222994 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneN/A
-
Vector typeMammalian Expression, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameHuEx-2xNLS-iGeoCas9(C2)-2xNLS_EGFP-g1
-
Alt nameiGeoCas9(C2)_EGFP-g1
-
SpeciesSynthetic
- Promoter pCAG
-
Tag
/ Fusion Protein
- Puro (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SalI (unknown if destroyed)
- 3′ cloning site MluI (unknown if destroyed)
- 5′ sequencing primer tttcaggttggaccggtgccacct
- 3′ sequencing primer tcgaggctgatcagcgagctcta
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
HuEx-2xNLS-iGeoCas9(C2)-2xNLS_EGFP-g1 was a gift from Jennifer Doudna (Addgene plasmid # 222994 ; http://n2t.net/addgene:222994 ; RRID:Addgene_222994) -
For your References section:
Rapid DNA unwinding accelerates genome editing by engineered CRISPR-Cas9. Eggers AR, Chen K, Soczek KM, Tuck OT, Doherty EE, Xu B, Trinidad MI, Thornton BW, Yoon PH, Doudna JA. Cell. 2024 May 13:S0092-8674(24)00457-4. doi: 10.1016/j.cell.2024.04.031. 10.1016/j.cell.2024.04.031 PubMed 38781968