PEmax_AAVS1_knockin_HDR_donor
(Plasmid
#223000)
-
PurposeHDR donor plasmid for PEmax knockin at AAVS1 locus. Left_homology_arm-splicing_acceptor-T2A-NeoR-bGHpA-pEF1α-PEmax-IRES2-EGFP-WPRE-βglobinpA-right_homology_arm
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 223000 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepBluescript
- Total vector size (bp) 15566
-
Vector typeMammalian Expression ; HDR donor
-
Selectable markersNeomycin (select with G418) ; EGFP
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePEmax
-
SpeciesSynthetic; SpCas9 is from Streptococcus pyogenes; MMLV_RT is from the Moloney murine leukemia virus
-
Insert Size (bp)6393
- Promoter EF1α
-
Tags
/ Fusion Proteins
- SV40 bpNLS (N terminal on insert)
- SV40 bpNLS (C terminal on insert)
- c-Myc NLS (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site MluI (not destroyed)
- 3′ cloning site BstXI (not destroyed)
- 5′ sequencing primer CGAAAGCAGCGAGACAGG
- 3′ sequencing primer TGGCTCTCCTCAAGCGTATT
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PEmax_AAVS1_knockin_HDR_donor was a gift from Brittany Adamson (Addgene plasmid # 223000 ; http://n2t.net/addgene:223000 ; RRID:Addgene_223000) -
For your References section:
Improving prime editing with an endogenous small RNA-binding protein. Yan J, Oyler-Castrillo P, Ravisankar P, Ward CC, Levesque S, Jing Y, Simpson D, Zhao A, Li H, Yan W, Goudy L, Schmidt R, Solley SC, Gilbert LA, Chan MM, Bauer DE, Marson A, Parsons LR, Adamson B. Nature. 2024 Apr 3. doi: 10.1038/s41586-024-07259-6. 10.1038/s41586-024-07259-6 PubMed 38570691