Skip to main content
Addgene

Lenti:FlipGFP-T2A-mCherry
(Plasmid #223198)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 223198 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    Addgene #61422
  • Backbone manufacturer
    Addgene
  • Modifications to backbone
    dCas9VP64-T2A-EGFP in Addgene #61422 was swapped with FlipGFP-T2A-mCherry (retrieved from Addgene #124428)
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    FlipGFP-T2A-mCherry
  • Species
    Synthetic
  • Promoter EF1a

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsiWI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer TCAAGCCTCAGACAGTGGTTC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Xiaokun Shu and Feng Zhang (Addgene plasmids #124428 and #61422 respectively).

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Lenti:FlipGFP-T2A-mCherry was a gift from Yeh-Hsing Lao (Addgene plasmid # 223198 ; http://n2t.net/addgene:223198 ; RRID:Addgene_223198)
  • For your References section:

    Enabling continuous immune cell recirculation on a microfluidic array to study immunotherapeutic interactions in a recapitulated tumour microenvironment. Chi CW, Lao YH, Ahmed AHR, He S, Merghoub T, Leong KW, Wang S. Lab Chip. 2024 Jan 30;24(3):396-407. doi: 10.1039/d3lc00662j. 10.1039/d3lc00662j PubMed 38180130