CaMKII-pHluorin-Synaptotagmin1
(Plasmid
#224430)
-
PurposeExpression of Synaptotagmin1-pHluorin for optical monitoring of synaptic vesicle cycling in neurons
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 224430 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneCamKII-LGI1-pHluorin
-
Backbone manufacturerThermo Fisher Scientific
- Backbone size w/o insert (bp) 2115
- Total vector size (bp) 11354
-
Modifications to backboneReplace LGI1 with Synaptotagmin1
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersBleomycin resistance
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSynaptotagmin1-pHluorin
-
Alt nameTagmin1-pH
-
SpeciesR. norvegicus (rat)
-
Insert Size (bp)11354
-
GenBank IDNM_25716
- Promoter CaMKII
-
Tag
/ Fusion Protein
- pHluorin
Cloning Information
- Cloning method Gene Synthesis
- 5′ sequencing primer CGAGTGGCCCCTAGTTCTGG
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2024.04.19.590083 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CaMKII-pHluorin-Synaptotagmin1 was a gift from Jaime de Juan-Sanz (Addgene plasmid # 224430 ; http://n2t.net/addgene:224430 ; RRID:Addgene_224430) -
For your References section:
Monitoring of activity-driven trafficking of endogenous synaptic proteins through proximity labeling. Pascual-Caro C, de Juan-Sanz J. PLoS Biol. 2024 Oct 28;22(10):e3002860. doi: 10.1371/journal.pbio.3002860. eCollection 2024 Oct. 10.1371/journal.pbio.3002860 PubMed 39466808