pLUEF1 Luc2-IRES-GFP
(Plasmid
#224467)
-
PurposeEf1a downstream of a ubiquitous chromatin opening element drives expression of Luciferase2 and IRES GFP
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 224467 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLUEF1-IRES-GFP
-
Modifications to backboneLuc2 was amplified from pFU Luc2-eGFP (a gift from Professor Jennifer Prescher) plasmid using primers: cgagactagcctcgaggtttaaacATGGAAGATGCCAAAAAC forward and attcctgcagcccgtagtttaaacTTATTACACGGCGATCTTG reverse and Gibson cloned into pLUEF1-IRES-GFP between Pmei restriction sites.
-
Vector typeLentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameLuciferase
-
Alt nameLuc2
-
SpeciesPhotonis pyralis (firefly)
-
Insert Size (bp)1656
-
GenBank IDAY738222 AY738222
- Promoter EF1a
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TCAAGCCTCAGACAGTGGTTC
- 3′ sequencing primer CCTCACATTGCCAAAAGACG
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThe Luc2 gene was amplified from pFU Luc2-eGFP (a gift from Professor Jennifer Prescher)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLUEF1 Luc2-IRES-GFP was a gift from Robert Kerbel (Addgene plasmid # 224467 ; http://n2t.net/addgene:224467 ; RRID:Addgene_224467) -
For your References section:
Immunological Tolerance to Luciferase and Fluorescent Proteins using Tol Mice Enables Development of Improved Tumor Models for Investigating Immunity and Metastasis. Khan KA, Qureshi AA, Xu P, Kuo HY, Schumacher TN, Michael IP, Kerbel RS. Cancer Res. 2025 Apr 14. doi: 10.1158/0008-5472.CAN-24-2418. 10.1158/0008-5472.CAN-24-2418 PubMed 40228139