pRSET OCaMP
(Plasmid
#224932)
-
PurposeExpresses OCaMP, an orange calcium indicator, in bacteria. Contains T7 promoter and RSET leader sequence peptide (His tag, T7 leader, Xpress epitope)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 224932 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 * |
* Log in to view industry pricing.
Backbone
-
Vector backbonepRSET
- Total vector size (bp) 5679
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameOCaMP
-
Alt nameOrange calcium indicator
-
Alt nameOGECI
-
SpeciesSynthetic; Bacteria (E.coli)
-
Insert Size (bp)1342
- Promoter T7
-
Tags
/ Fusion Proteins
- 6xHis (N terminal on backbone)
- Xpress tag (N terminal on backbone)
- RSET peptide (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (unknown if destroyed)
- 3′ cloning site EcoRI (unknown if destroyed)
- 5′ sequencing primer tagggagaccacaacggtttccctctagaaataattttgtttaa (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2025.07.28.667269 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRSET OCaMP was a gift from Alexander Lohman (Addgene plasmid # 224932 ; http://n2t.net/addgene:224932 ; RRID:Addgene_224932) -
For your References section:
A sensitive orange fluorescent calcium ion indicator for imaging neural activity. Aggarwal A, Baker HA, Durst CD, Chen I-W, de Chambrier P, Gonzales JM, Marvin JS, Vandal M, Lundberg T, Sakoi K, Patel RH, Wang C-Y, Visser F, Fouad Y, Sunil S, Wiens M, Terai T, Takahashi-Yamashiro K, Thompson RJ, Brown TA, Nasu Y, Nguyen MD, Gordon GRJ, McFarlane S, Podgorski K, Holtmaat A, Campbell RE, Lohman AW. bioRxiv 2025.07.28.667269; doi: https://doi.org/10.1101/2025.07.28.667269 10.1101/2025.07.28.667269