Skip to main content
Addgene

pAAV-EF1a-FLEX(FLP)-OCaMP-WPRE
(Plasmid #224936)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 224936 Standard format: Plasmid sent in bacteria as agar stab 1 $89 *

* Log in to view industry pricing.

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.
  • Serotype
    Select serotype for details
  • Pricing
    Select serotype and quantity
  • How this works
    • Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
    • Addgene will quickly confirm that we can produce a high-quality prep for you.
    • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
    • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
    • Learn more about our Packaged on Request Service.

Backbone

  • Vector backbone
    pAAV Ef1a FLP
  • Total vector size (bp) 6641
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    OCaMP
  • Alt name
    Orange calcium indicator
  • Alt name
    OGECI
  • Species
    M. musculus (mouse), R. norvegicus (rat), Synthetic
  • Insert Size (bp)
    1342
  • Promoter Ef1a
  • Tag / Fusion Protein
    • 6xHis (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (unknown if destroyed)
  • 3′ cloning site AscI (unknown if destroyed)
  • 5′ sequencing primer atggtgcaaagagaagttcctataccttttgaagaataggaact
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://doi.org/10.1101/2025.07.28.667269 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-EF1a-FLEX(FLP)-OCaMP-WPRE was a gift from Alexander Lohman (Addgene plasmid # 224936 ; http://n2t.net/addgene:224936 ; RRID:Addgene_224936)
  • For your References section:

    A sensitive orange fluorescent calcium ion indicator for imaging neural activity. Aggarwal A, Baker HA, Durst CD, Chen I-W, de Chambrier P, Gonzales JM, Marvin JS, Vandal M, Lundberg T, Sakoi K, Patel RH, Wang C-Y, Visser F, Fouad Y, Sunil S, Wiens M, Terai T, Takahashi-Yamashiro K, Thompson RJ, Brown TA, Nasu Y, Nguyen MD, Gordon GRJ, McFarlane S, Podgorski K, Holtmaat A, Campbell RE, Lohman AW. bioRxiv 2025.07.28.667269; doi: https://doi.org/10.1101/2025.07.28.667269 10.1101/2025.07.28.667269