pAAV-EF1a-FLEX(FLP)-OCaMP-WPRE
(Plasmid
#224936)
-
PurposepAAV vector for flippase(FLP)-dependent OCaMP (orange calcium indicator) expression under the control of EF1a promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 224936 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 * |
* Log in to view industry pricing.
Backbone
-
Vector backbonepAAV Ef1a FLP
- Total vector size (bp) 6641
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameOCaMP
-
Alt nameOrange calcium indicator
-
Alt nameOGECI
-
SpeciesM. musculus (mouse), R. norvegicus (rat), Synthetic
-
Insert Size (bp)1342
- Promoter Ef1a
-
Tag
/ Fusion Protein
- 6xHis (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (unknown if destroyed)
- 3′ cloning site AscI (unknown if destroyed)
- 5′ sequencing primer atggtgcaaagagaagttcctataccttttgaagaataggaact (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2025.07.28.667269 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-EF1a-FLEX(FLP)-OCaMP-WPRE was a gift from Alexander Lohman (Addgene plasmid # 224936 ; http://n2t.net/addgene:224936 ; RRID:Addgene_224936) -
For your References section:
A sensitive orange fluorescent calcium ion indicator for imaging neural activity. Aggarwal A, Baker HA, Durst CD, Chen I-W, de Chambrier P, Gonzales JM, Marvin JS, Vandal M, Lundberg T, Sakoi K, Patel RH, Wang C-Y, Visser F, Fouad Y, Sunil S, Wiens M, Terai T, Takahashi-Yamashiro K, Thompson RJ, Brown TA, Nasu Y, Nguyen MD, Gordon GRJ, McFarlane S, Podgorski K, Holtmaat A, Campbell RE, Lohman AW. bioRxiv 2025.07.28.667269; doi: https://doi.org/10.1101/2025.07.28.667269 10.1101/2025.07.28.667269