Skip to main content
Addgene

pSicoR (GFP) cRel shRNA1
(Plasmid #22509)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 22509 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pSicoR GFP
  • Backbone manufacturer
    Available at Addgene (#11579)
  • Backbone size w/o insert (bp) 7500
  • Vector type
    Mammalian Expression, Lentiviral, RNAi, Cre/Lox

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    cRel shRNA1
  • Alt name
    cRel
  • Species
    M. musculus (mouse)
  • Entrez Gene
    Rel (a.k.a. c-Rel)

Cloning Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Mouse cRel shRNA1 in pSicoReverse (GFP)
forward oligo:
TGGAATGCGGTTTAGATACATTCAAGAGATGTATCTAAACCGCATTCCTTTTTTC
reverse oligo :
TCGAGAAAAAAGGAATGCGGTTTAGATACATCTCTTGAATGTATCTAAACCGCATTCCA

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSicoR (GFP) cRel shRNA1 was a gift from Tyler Jacks (Addgene plasmid # 22509 ; http://n2t.net/addgene:22509 ; RRID:Addgene_22509)
  • For your References section:

    Requirement for NF-kappaB signalling in a mouse model of lung adenocarcinoma. Meylan E, Dooley AL, Feldser DM, Shen L, Turk E, Ouyang C, Jacks T. Nature. 2009 Nov 5;462(7269):104-7. doi: 10.1038/nature08462. Epub 2009 Oct 21. 10.1038/nature08462 PubMed 19847165