pP4-C
(Plasmid
#225097)
-
PurposegfpUV reporter vector with a high performance adenine-dependent riboswitch
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 225097 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepBR322
- Backbone size w/o insert (bp) 4000
- Total vector size (bp) 4615
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namesynthetic riboswitch
-
SpeciesBacillus subtilis
-
Insert Size (bp)200
- Promoter synthetic constitutive promoter
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NciI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer GCGCTAGCCACAGCTAACAC
- 3′ sequencing primer GTGTTGGCCATGGAACAGGTAGTTTTCCAG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pP4-C was a gift from Robert Batey (Addgene plasmid # 225097 ; http://n2t.net/addgene:225097 ; RRID:Addgene_225097) -
For your References section:
Requirements for efficient ligand-gated co-transcriptional switching in designed variants of the B. subtilis pbuE adenine-responsive riboswitch in E. coli. Drogalis LK, Batey RT. PLoS One. 2020 Dec 1;15(12):e0243155. doi: 10.1371/journal.pone.0243155. eCollection 2020. 10.1371/journal.pone.0243155 PubMed 33259551