pAJE-Ma pylRS nitroY/haloY-F5
(Plasmid
#225684)
-
PurposeExpresses Methanomethylophilus alvus pyrrolysine tRNA synthetase engineered for 3-nitroY and 3-haloY under GlnS promoter. Used as a control during Ma Pyl tRNA-synthetase validation.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 225684 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepAJE-Ma
- Backbone size w/o insert (bp) 3219
- Total vector size (bp) 4044
-
Vector typeMethanomethylophilus alvus
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameM. alvus PylRS 3-NY/HaloY F5
-
Alt nameNYF5
-
SpeciesMethanomethylophilus alvus
-
MutationCTG125CTT, N166A, V168S, A223C, W239R
- Promoter GlnS
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (not destroyed)
- 3′ cloning site PstI (not destroyed)
- 5′ sequencing primer tgctgagttgaaggatcctcgg
- 3′ sequencing primer gtgaacgccttatccggcctac
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameM. alvus Pyl-tRNA(6)
-
SpeciesMethanomethylophilus alvus
-
Insert Size (bp)75
- Promoter Lpp
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site BsmBI,BglII (unknown if destroyed)
- 3′ cloning site SpeI,HindIII (unknown if destroyed)
- 5′ sequencing primer TTCTGTTGCCCGTCTCACTGG
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Expresses a) Methanomethylophilus alvus pyrrolysine tRNA synthetase (MaPylRS) engineered for 3-nitrotyrosine and 3-halotryosines under GlnS promoter and b) Methanomethylophilus alvus pyrrolysine tRNA under an Lpp promoter(6). Used as a control for Ma Pyl tRNA-synthetase validation for BL21 or similar cell lines. This plasmid expresses the MaRS and Pyl tRNA and must be paired with a plasmid containing a gene of interest with an amber codon for nitroTyr/haloTyr incorporation.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAJE-Ma pylRS nitroY/haloY-F5 was a gift from Ryan Mehl (Addgene plasmid # 225684 ; http://n2t.net/addgene:225684 ; RRID:Addgene_225684)