pCF142_U6-sgRNA
(Plasmid
#225960)
-
PurposeU6-sgRNA (recipient). Expresses U6-sgRNA (recipient) for VLP production. This is a recipient vector for cloning of specific SpyCas9 sgRNAs.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 225960 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCF142
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameU6-sgRNA (recipient)
-
gRNA/shRNA sequenceggagacggaggacgacgaacgtctct
-
SpeciesSpacer (Esp3I)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2024.06.25.600517 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCF142_U6-sgRNA was a gift from Christof Fellmann (Addgene plasmid # 225960 ; http://n2t.net/addgene:225960 ; RRID:Addgene_225960) -
For your References section:
Neuronal DNA repair reveals strategies to influence CRISPR editing outcomes. Ramadoss GN, Namaganda SJ, Hamilton JR, Sharma R, Chow KG, Macklin BL, Sun M, Liu JC, Fellmann C, Watry HL, Jin J, Perez BS, Sandoval Espinoza CR, Matia MP, Lu SH, Judge LM, Nussenzweig A, Adamson B, Murthy N, Doudna JA, Kampmann M, Conklin BR. bioRxiv [Preprint]. 2024 Jun 26:2024.06.25.600517. doi: 10.1101/2024.06.25.600517. 10.1101/2024.06.25.600517 PubMed 38979269