-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 22662 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepCDHblast
- Backbone size w/o insert (bp) 7000
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameLaminAd50 (=Progerin)
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2000
-
Mutation50AA deletion creating Progerin instead of mature LMNA
-
Tag
/ Fusion Protein
- Onestrep Tag (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site EcoRI, XhoI, NotI, SwaI, BglII, AsuII (not destroyed)
- 5′ sequencing primer AAATGGGCGGTAGGCGTGT
- 3′ sequencing primer TCTCTAGGCACCCGTTCAAT (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCDHblast MCSNard OST-LMNAd50 was a gift from Tom Misteli (Addgene plasmid # 22662 ; http://n2t.net/addgene:22662 ; RRID:Addgene_22662) -
For your References section:
Ageing-related chromatin defects through loss of the NURD complex. Pegoraro G, Kubben N, Wickert U, Göhler H, Hoffmann K, Misteli T. Nat Cell Biol. 2009 Oct . 11(10):1261-7. 10.1038/ncb1971 PubMed 19734887