pOGS539_rPD-L1nb
(Plasmid
#226717)
-
PurposePlasmid enabling yeast-mediated expression and secretion of recombinant PD-L1 nanobody (rPD-L1nb)
-
Depositing Lab
-
Sequence Information
-
Sequences (1) — Accept Affinity Reagent Sequence Policy
-
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 226717 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backboneOGS539
-
Backbone manufacturerSigma-Aldrich
- Backbone size w/o insert (bp) 6846
- Total vector size (bp) 7559
-
Vector typeYeast Expression
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameRecombinant PD-L1 nanobody
-
Alt namerPD-L1nb
-
SpeciesCamelidae
-
Insert Size (bp)713
- Promoter pTEF1
-
Tags
/ Fusion Proteins
- HA tag (N terminal on insert)
- Mating factor alpha secretion signal (N terminal on insert)
- Histidine tag (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CATATCACATAGGAAGCAACAG
- 3′ sequencing primer CTACGATACCGATAGAGATGG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byPMID: 32051224; PDB: 5DXW
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pOGS539_rPD-L1nb was a gift from Gautam Dantas (Addgene plasmid # 226717 ; http://n2t.net/addgene:226717 ; RRID:Addgene_226717) -
For your References section:
A yeast-based oral therapeutic delivers immune checkpoint inhibitors to reduce intestinal tumor burden. Rebeck ON, Wallace MJ, Prusa J, Ning J, Evbuomwan EM, Rengarajan S, Habimana-Griffin L, Kwak S, Zahrah D, Tung J, Liao J, Mahmud B, Fishbein SRS, Ramirez Tovar ES, Mehta R, Wang B, Gorelik MG, Helmink BA, Dantas G. Cell Chem Biol. 2024 Nov 16:S2451-9456(24)00452-5. doi: 10.1016/j.chembiol.2024.10.013. 10.1016/j.chembiol.2024.10.013 PubMed 39571582