pTRIP-hPGK-Blast-2A-STING-mNeonGreen
(Plasmid
#227186)
-
PurposeLentiviral expression plasmid encoding STING-mNeonGreen under hPGK promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 227186 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepTRIP
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameSTING1
-
SpeciesH. sapiens (human)
-
Entrez GeneSTING1 (a.k.a. ERIS, MITA, MPYS, NET23, SAVI, STING, STING-beta, TMEM173, hMITA, hSTING)
-
Tag
/ Fusion Protein
- mNeonGreen (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer gattcgtgaattgctgccct
- 3′ sequencing primer atgctgattgtgcctggcta (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2024.04.07.588166 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTRIP-hPGK-Blast-2A-STING-mNeonGreen was a gift from Nir Hacohen (Addgene plasmid # 227186 ; http://n2t.net/addgene:227186 ; RRID:Addgene_227186) -
For your References section:
Classification and functional characterization of regulators of intracellular STING trafficking identified by genome-wide optical pooled screening. Gentili M, Carlson RJ, Liu B, Hellier Q, Andrews J, Qin Y, Blainey PC, Hacohen N. Cell Syst. 2024 Dec 18;15(12):1264-1277.e8. doi: 10.1016/j.cels.2024.11.004. Epub 2024 Dec 9. 10.1016/j.cels.2024.11.004 PubMed 39657680