-
Purpose(Empty Backbone)
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 22744 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepBABE-puro
-
Backbone manufacturerWeinberg lab (Addgene#:1764)
- Backbone size (bp) 5169
-
Modifications to backboneNon-targeting complementary sites (7x in tandem) to serve as a negative control for microRNA sponge-mediated inhibition of specific microRNA function; suitable for stable expression. Note that EGFP is also cloned into this backbone, upstream of the sponge.
-
Vector typeMammalian Expression, Retroviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCXCR4 control sponge
-
Alt namestable control sponge
-
Insert Size (bp)2000
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (unknown if destroyed)
- 3′ cloning site ApaI (unknown if destroyed)
- 5′ sequencing primer pBabe-5
- 3′ sequencing primer pBabe-3 (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Subclond from CMV-CXCR4 control sponge, as described in Ebert et al. (Nature Methods, 2007)
Sequence of sponge: AAGUUUUCAGAAAGCUAACA
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBp-Control Sponge (CXCR4 sponge) was a gift from Bob Weinberg (Addgene plasmid # 22744 ; http://n2t.net/addgene:22744 ; RRID:Addgene_22744) -
For your References section:
A pleiotropically acting microRNA, miR-31, inhibits breast cancer metastasis. Valastyan S, Reinhardt F, Benaich N, Calogrias D, Szasz AM, Wang ZC, Brock JE, Richardson AL, Weinberg RA. Cell. 2009 Jun 12. 137(6):1032-46. 10.1016/j.cell.2009.03.047 PubMed 19524507