pLKO-1: shALAS-1
(Plasmid
#22750)
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 22750 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLKO.1
-
Backbone manufacturerAvailable at Addgene (#8453)
- Backbone size w/o insert (bp) 7000
-
Vector typeMammalian Expression, Lentiviral, RNAi
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameshALAS-1
-
Alt nameALAS1
-
Alt nameALAS-1
-
SpeciesM. musculus (mouse)
-
Entrez GeneAlas1 (a.k.a. ALAS, ALAS-N, Alas-1, Alas-h)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (unknown if destroyed)
- 3′ cloning site EcoRI (unknown if destroyed)
- 5′ sequencing primer pLKO.1 5' (Common Sequencing Primers)
Resource Information
-
Reference
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
targeting sequence: CCAAGATAGTAGCATTTGAAA
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLKO-1: shALAS-1 was a gift from Bruce Spiegelman (Addgene plasmid # 22750 ; http://n2t.net/addgene:22750 ; RRID:Addgene_22750) -
For your References section:
PGC-1alpha negatively regulates hepatic FGF21 expression by modulating the heme/Rev-Erb(alpha) axis. Estall JL, Ruas JL, Choi CS, Laznik D, Badman M, Maratos-Flier E, Shulman GI, Spiegelman BM. Proc Natl Acad Sci U S A. 2009 Dec 29. 106(52):22510-5. 10.1073/pnas.0912533106 PubMed 20018698