BCL2alpha-MJK2243
(Plasmid
#227690)
-
PurposeExpresses human BCL2alpha
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 227690 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepMJK2243
- Backbone size w/o insert (bp) 10753
- Total vector size (bp) 11448
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namehuman BCL-2alpha
-
Alt nameBCL2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)720
-
GenBank IDNM_000633.3 NP_000624.2
-
Entrez GeneBCL2 (a.k.a. Bcl-2, PPP1R50)
- Promoter EF1a
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site KpnI (not destroyed)
- 5′ sequencing primer CTCAAGCCTCAGACAGTGGTTC
- 3′ sequencing primer CCACATAGCGTAAAAGGAGCAACATAG (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
BCL2alpha-MJK2243 was a gift from Curt Civin (Addgene plasmid # 227690 ; http://n2t.net/addgene:227690 ; RRID:Addgene_227690) -
For your References section:
The polypharmacy combination of the BCL-2 inhibitor venetoclax (VEN) and the FLT3 inhibitor gilteritinib (GIL) is more active in acute myeloid leukemia cells than novel polypharmacologic BCL-2/FLT3 VEN-GIL hybrid single-molecule inhibitors. Goodis CC, Eberly C, Chan AM, Kim M, Lowe BD, Civin CI, Fletcher S. Eur J Med Chem. 2024 Dec 22;285:117190. doi: 10.1016/j.ejmech.2024.117190. 10.1016/j.ejmech.2024.117190 PubMed 39813774