pMH4-SYN-ChR2-tdimer2RFP
(Plasmid
#22772)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 22772 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepMH4
- Backbone size w/o insert (bp) 7037
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsDH5alpha, JM109 high efficiency
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameChR2-tdimer2RFP
-
Speciesmixture
-
Insert Size (bp)2330
-
Tag
/ Fusion Protein
- ChR2-tdimer2RFP
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site SAlI (not destroyed)
- 5′ sequencing primer gactcagcgctgcctcagtctg
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byKarl Deisseroth, Stanford; Roger Y. Tsien, San Diego
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
ChR2 seq.5'-3' 870-1796=926bp;
tdimer2RFP 5'-3' 1809-3200=1391bp
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMH4-SYN-ChR2-tdimer2RFP was a gift from Thomas Oertner (Addgene plasmid # 22772 ; http://n2t.net/addgene:22772 ; RRID:Addgene_22772) -
For your References section:
Optical induction of plasticity at single synapses reveals input-specific accumulation of alphaCaMKII. Zhang YP, Holbro N, Oertner TG. Proc Natl Acad Sci U S A. 2008 Aug 19. 105(33):12039-44. 10.1073/pnas.0802940105 PubMed 18697934