pET28a-AlkB
(Plasmid
#228218)
-
PurposeExpress wild type AlkB protein in E. coli BL21(DE3)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 228218 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepET28a(+)
-
Backbone manufacturerGenScript
- Backbone size w/o insert (bp) 5369
- Total vector size (bp) 5984
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsUse E. coli BL21 (DE3) cells for protein expression and purification.
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameAlpha-ketoglutarate-dependent Dioxygenase
-
Alt nameAlkB
-
SpeciesSynthetic
-
Insert Size (bp)660
-
Mutationcodon optimized
-
Entrez GenealkB (a.k.a. b2212, ECK2204, aidD)
- Promoter T7
-
Tag
/ Fusion Protein
- His tag (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Ndel (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer GCTAGTTATTGCTCAGCGG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byMenghong Yan from Fudan University
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET28a-AlkB was a gift from Junchao Shi (Addgene plasmid # 228218 ; http://n2t.net/addgene:228218 ; RRID:Addgene_228218) -
For your References section:
PANDORA-seq expands the repertoire of regulatory small RNAs by overcoming RNA modifications. Shi J, Zhang Y, Tan D, Zhang X, Yan M, Zhang Y, Franklin R, Shahbazi M, Mackinlay K, Liu S, Kuhle B, James ER, Zhang L, Qu Y, Zhai Q, Zhao W, Zhao L, Zhou C, Gu W, Murn J, Guo J, Carrell DT, Wang Y, Chen X, Cairns BR, Yang XL, Schimmel P, Zernicka-Goetz M, Cheloufi S, Zhang Y, Zhou T, Chen Q. Nat Cell Biol. 2021 Apr;23(4):424-436. doi: 10.1038/s41556-021-00652-7. Epub 2021 Apr 5. 10.1038/s41556-021-00652-7 PubMed 33820973