Skip to main content
Addgene

pET28a-AlkB
(Plasmid #228218)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 228218 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pET28a(+)
  • Backbone manufacturer
    GenScript
  • Backbone size w/o insert (bp) 5369
  • Total vector size (bp) 5984
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    Use E. coli BL21 (DE3) cells for protein expression and purification.
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Alpha-ketoglutarate-dependent Dioxygenase
  • Alt name
    AlkB
  • Species
    Synthetic
  • Insert Size (bp)
    660
  • Mutation
    codon optimized
  • Entrez Gene
    alkB (a.k.a. b2212, ECK2204, aidD)
  • Promoter T7
  • Tag / Fusion Protein
    • His tag (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Ndel (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer GCTAGTTATTGCTCAGCGG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Menghong Yan from Fudan University

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pET28a-AlkB was a gift from Junchao Shi (Addgene plasmid # 228218 ; http://n2t.net/addgene:228218 ; RRID:Addgene_228218)
  • For your References section:

    PANDORA-seq expands the repertoire of regulatory small RNAs by overcoming RNA modifications. Shi J, Zhang Y, Tan D, Zhang X, Yan M, Zhang Y, Franklin R, Shahbazi M, Mackinlay K, Liu S, Kuhle B, James ER, Zhang L, Qu Y, Zhai Q, Zhao W, Zhao L, Zhou C, Gu W, Murn J, Guo J, Carrell DT, Wang Y, Chen X, Cairns BR, Yang XL, Schimmel P, Zernicka-Goetz M, Cheloufi S, Zhang Y, Zhou T, Chen Q. Nat Cell Biol. 2021 Apr;23(4):424-436. doi: 10.1038/s41556-021-00652-7. Epub 2021 Apr 5. 10.1038/s41556-021-00652-7 PubMed 33820973