Skip to main content

Epac-S-H328
(Plasmid #228244)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 228244 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pcDNA3
  • Backbone size w/o insert (bp) 5500
  • Total vector size (bp) 9846
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    mT2Del_EPACdDEPCD_Q270E_M312L_E325T_L777A_K778A_tdBlackcp173Venus(ST)
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    4445
  • Mutation
    Deletion of DEP domain, Catalytically dead T781A & F782A, increased affinity for cAMP Q270E & M312L & E325T, no nuclear envelope affinity L777A & K778A, Black Venus Y145W
  • Entrez Gene
    RAPGEF3 (a.k.a. CAMP-GEFI, EPAC, EPAC1, HSU79275, bcm910)
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NotI (unknown if destroyed)
  • 3′ cloning site EcoRI (unknown if destroyed)
  • 5′ sequencing primer CACGACTGGAGCCTCTTCAACA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://doi.org/10.1101/2024.09.30.615785 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Epac-S-H328 was a gift from Kees Jalink (Addgene plasmid # 228244 ; http://n2t.net/addgene:228244 ; RRID:Addgene_228244)
  • For your References section:

    Cytosolic-enhanced dark Epac-based FRET sensors allow for intracellular cAMP detection in live cells via FLIM. Zanetti G, Klarenbeek JB, Jalink K. FEBS Lett. 2024 Dec 31. doi: 10.1002/1873-3468.15093. 10.1002/1873-3468.15093 PubMed 39737677