Epac-S-H329
(Plasmid
#228245)
-
PurposemT2Del_EPACdDEPCD_Q270E_E325T_L777A_K778A_tdBlackcp173Venus(ST) biosensor to measure realtime changes in FRET reflecting fluctuations in cAMP levels in living cells.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 228245 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepcDNA3
- Backbone size w/o insert (bp) 5500
- Total vector size (bp) 9846
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemT2Del_EPACdDEPCD_Q270E_E325T_L777A_K778A_tdBlackcp173Venus(ST)
-
SpeciesH. sapiens (human)
-
Insert Size (bp)4445
-
MutationDeletion of DEP domain, Catalytically dead T781A & F782A, increased affinity for cAMP Q270E & E325T, no nuclear envelope affinity L777A & K778A, Black Venus Y145W
-
Entrez GeneRAPGEF3 (a.k.a. CAMP-GEFI, EPAC, EPAC1, HSU79275, bcm910)
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NotI (unknown if destroyed)
- 3′ cloning site EcoRI (unknown if destroyed)
- 5′ sequencing primer CACGACTGGAGCCTCTTCAACA
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2024.09.30.615785 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Epac-S-H329 was a gift from Kees Jalink (Addgene plasmid # 228245 ; http://n2t.net/addgene:228245 ; RRID:Addgene_228245) -
For your References section:
Cytosolic-enhanced dark Epac-based FRET sensors allow for intracellular cAMP detection in live cells via FLIM. Zanetti G, Klarenbeek JB, Jalink K. FEBS Lett. 2024 Dec 31. doi: 10.1002/1873-3468.15093. 10.1002/1873-3468.15093 PubMed 39737677