Skip to main content

pAAV-U6-SpCas9_gRNA(RHO-P23H)-CMV-mTagBFP2_(RAS3613)
(Plasmid #228252)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 228252 Standard format: Plasmid sent in bacteria as agar stab 1 $89

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.
  • Serotype
    Select serotype for details
  • Pricing
    Select serotype and quantity
  • How this works
    • Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
    • Addgene will quickly confirm that we can produce a high-quality prep for you.
    • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
    • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
    • Learn more about our Packaged on Request Service.

Backbone

  • Vector backbone
    pAAV
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    SpCas9 P23H sgRNA, mTagBFP2
  • Alt name
    RAS2613
  • gRNA/shRNA sequence
    GTAGTACTGTGGGTACTCGA
  • Species
    Synthetic
  • Mutation
    n/a
  • Promoter CMV and U6

Cloning Information

  • Cloning method Gibson Cloning

Resource Information

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-U6-SpCas9_gRNA(RHO-P23H)-CMV-mTagBFP2_(RAS3613) was a gift from Benjamin Kleinstiver (Addgene plasmid # 228252 ; http://n2t.net/addgene:228252 ; RRID:Addgene_228252)
  • For your References section:

    Custom CRISPR-Cas9 PAM variants via scalable engineering and machine learning. Silverstein RA, Kim N, Kroell AS, Walton RT, Delano J, Butcher RM, Pacesa M, Smith BK, Christie KA, Ha LL, Meis RJ, Clark AB, Spinner AD, Lazzarotto CR, Li Y, Matsubara A, Urbina EO, Dahl GA, Correia BE, Marks DS, Tsai SQ, Pinello L, De Ravin SS, Liu Q, Kleinstiver BP. Nature. 2025 Apr 22. doi: 10.1038/s41586-025-09021-y. 10.1038/s41586-025-09021-y PubMed 40262634