pAAV-U6-SpCas9_gRNA(RHO-P23H)-CMV-mTagBFP2_(RAS3613)
(Plasmid
#228252)
-
PurposepU6 (human U6) expression of SpCas9 sgRNA targeting RHO P23H mutation and pCMV expression of mTagBFP2
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 228252 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $32 USD for plasmid.
-
How this works
- Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backbonepAAV
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSpCas9 P23H sgRNA, mTagBFP2
-
Alt nameRAS2613
-
gRNA/shRNA sequenceGTAGTACTGTGGGTACTCGA
-
SpeciesSynthetic
-
Mutationn/a
- Promoter CMV and U6
Cloning Information
- Cloning method Gibson Cloning
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-U6-SpCas9_gRNA(RHO-P23H)-CMV-mTagBFP2_(RAS3613) was a gift from Benjamin Kleinstiver (Addgene plasmid # 228252 ; http://n2t.net/addgene:228252 ; RRID:Addgene_228252) -
For your References section:
Custom CRISPR-Cas9 PAM variants via scalable engineering and machine learning. Silverstein RA, Kim N, Kroell AS, Walton RT, Delano J, Butcher RM, Pacesa M, Smith BK, Christie KA, Ha LL, Meis RJ, Clark AB, Spinner AD, Lazzarotto CR, Li Y, Matsubara A, Urbina EO, Dahl GA, Correia BE, Marks DS, Tsai SQ, Pinello L, De Ravin SS, Liu Q, Kleinstiver BP. Nature. 2025 Apr 22. doi: 10.1038/s41586-025-09021-y. 10.1038/s41586-025-09021-y PubMed 40262634