pBbS5a-OptoCre-REDMAP
(Plasmid
#228465)
-
PurposeLight-inducible Cre recombinase split with REDMAP photoreceptors for bacterial expression
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 228465 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepBbS5a
- Backbone size w/o insert (bp) 4849
- Total vector size (bp) 8650
-
Vector typeBacterial Expression, Cre/Lox
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameOptoCre-REDMAP
-
Alt nameOptoCre-REDMAP
-
SpeciesSynthetic
-
Insert Size (bp)3801
- Promoter pLacUV5
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer gcgtagaggatcgagatcgtttaggcaccc
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBbS5a-OptoCre-REDMAP was a gift from Mary Dunlop (Addgene plasmid # 228465 ; http://n2t.net/addgene:228465 ; RRID:Addgene_228465) -
For your References section:
Red Light Responsive Cre Recombinase for Bacterial Optogenetics. Jafarbeglou F, Dunlop MJ. ACS Synth Biol. 2024 Nov 19. doi: 10.1021/acssynbio.4c00388. 10.1021/acssynbio.4c00388 PubMed 39558834