pBbAk-w4-loxP-TT-loxP-mCherry-PCB
(Plasmid
#228469)
-
PurposeFluorescent reporter for Cre recombinase activity and the PCB production gene. Cre removes a transcription terminator, leading to mCherry production
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 228469 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepBbAk
- Backbone size w/o insert (bp) 2455
- Total vector size (bp) 5200
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert namew4-loxP-TT-loxP-mCherry
-
SpeciesSynthetic
-
Insert Size (bp)1051
- Promoter T7A1
Cloning Information for Gene/Insert 1
- Cloning method Unknown
- 5′ sequencing primer acgaggccctttgagTTATCAAAAAGAGTA
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameHo1
-
SpeciesSynthetic
-
Insert Size (bp)723
- Promoter J23108
Cloning Information for Gene/Insert 2
- Cloning method Unknown
- 5′ sequencing primer TAGTAAATCACTGCATAATTCGTGTCG
- (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert namePcyA
-
SpeciesSynthetic
-
Insert Size (bp)747
- Promoter J23106
Cloning Information for Gene/Insert 3
- Cloning method Unknown
- 5′ sequencing primer GGTGTTCAACAGCCTCACCC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBbAk-w4-loxP-TT-loxP-mCherry-PCB was a gift from Mary Dunlop (Addgene plasmid # 228469 ; http://n2t.net/addgene:228469 ; RRID:Addgene_228469) -
For your References section:
Red Light Responsive Cre Recombinase for Bacterial Optogenetics. Jafarbeglou F, Dunlop MJ. ACS Synth Biol. 2024 Nov 19. doi: 10.1021/acssynbio.4c00388. 10.1021/acssynbio.4c00388 PubMed 39558834