pLBPVXBa-M
(Plasmid
#229079)
-
PurposeNew version of a PVX vector to express heterologous sequences in plants
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 229079 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLX-B2
- Total vector size (bp) 9921
-
Vector typePlant Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namePotato virus X
-
Alt namePVX
-
MutationMutation coat protein start codon (ATG to AGG); deletion coat protein 29 amino-terminal codons; insertion MluI cloning site; insertion heterologous promoter derived from bamboo mosaic virus
-
GenBank IDMT799816.1
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GGGAATCAATCACAGTGTTGGC
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLBPVXBa-M was a gift from Jose-Antonio Daros (Addgene plasmid # 229079 ; http://n2t.net/addgene:229079 ; RRID:Addgene_229079) -
For your References section:
RNA virus-mediated gene editing for tomato trait breeding. Uranga M, Aragones V, Garcia A, Mirabel S, Gianoglio S, Presa S, Granell A, Pasin F, Daros JA. Hortic Res. 2023 Dec 19;11(1):uhad279. doi: 10.1093/hr/uhad279. eCollection 2024 Jan. 10.1093/hr/uhad279 PubMed 38895601