AP1muA single guide RNA
(Plasmid
#230030)
-
Purposeguide RNA for AP1muA tagging at the C-terminus in pX459
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 230030 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonePX459
-
Backbone manufacturerFeng Zhang, Addgene plasmid #62988
-
Vector typeCRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameAP1M1 guide
-
gRNA/shRNA sequenceCAGCCAACACCCCGGCCTCG
-
SpeciesH. sapiens (human)
-
Entrez GeneAP1M1 (a.k.a. AP47, CLAPM2, CLTNM, MU-1A, mu1A)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AP1muA single guide RNA was a gift from Francesca Bottanelli (Addgene plasmid # 230030 ; http://n2t.net/addgene:230030 ; RRID:Addgene_230030) -
For your References section:
When less is more - a fast TurboID knock-in approach for high-sensitivity endogenous interactome mapping. Stockhammer A, Spalt C, Klemt A, Benz LS, Harel S, Natalia V, Wiench L, Freund C, Kuropka B, Bottanelli F. J Cell Sci. 2024 Aug 15;137(16):jcs261952. doi: 10.1242/jcs.261952. Epub 2024 Aug 28. 10.1242/jcs.261952 PubMed 39056144