Skip to main content

AP1muA single guide RNA
(Plasmid #230030)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 230030 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    PX459
  • Backbone manufacturer
    Feng Zhang, Addgene plasmid #62988
  • Vector type
    CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    AP1M1 guide
  • gRNA/shRNA sequence
    CAGCCAACACCCCGGCCTCG
  • Species
    H. sapiens (human)
  • Entrez Gene
    AP1M1 (a.k.a. AP47, CLAPM2, CLTNM, MU-1A, mu1A)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AP1muA single guide RNA was a gift from Francesca Bottanelli (Addgene plasmid # 230030 ; http://n2t.net/addgene:230030 ; RRID:Addgene_230030)
  • For your References section:

    When less is more - a fast TurboID knock-in approach for high-sensitivity endogenous interactome mapping. Stockhammer A, Spalt C, Klemt A, Benz LS, Harel S, Natalia V, Wiench L, Freund C, Kuropka B, Bottanelli F. J Cell Sci. 2024 Aug 15;137(16):jcs261952. doi: 10.1242/jcs.261952. Epub 2024 Aug 28. 10.1242/jcs.261952 PubMed 39056144