pLenti-HA-L2HGDH(opt)-FLAG
(Plasmid
#230089)
-
Purposeexpressing human L2HGDH
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 230089 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepCDH-CMV-Nluc-P2A-copGFP-T2A-Puro
-
Backbone manufacturerAddgene
- Backbone size w/o insert (bp) 8220
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameL2HGDH
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1427
-
MutationMultiple wobble mutations
-
Entrez GeneL2HGDH (a.k.a. DURANIN, FLJ12618, C14orf160)
- Promoter CMV
-
Tags
/ Fusion Proteins
- HA (N terminal on insert)
- FLAG (C terminal on insert)
Cloning Information
- Cloning method Gene Synthesis
- 5′ sequencing primer common
- 3′ sequencing primer CTTCCTCTGCCCTCTCCACT (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
codon-optomized, 5' Cloning Site: EcoRV (not destroyed), 3' Cloning Site: XhoI (not destroyed)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLenti-HA-L2HGDH(opt)-FLAG was a gift from Xingguo Zhu (Addgene plasmid # 230089 ; http://n2t.net/addgene:230089 ; RRID:Addgene_230089) -
For your References section:
Transsulfuration pathway activation attenuates oxidative stress and ferroptosis in sickle primary erythroblasts and transgenic mice. Xi C, Pang J, Xue W, Cui Y, Jiang N, Zhi W, Shi H, Horuzsko A, Pace BS, Zhu X. Commun Biol. 2025 Jan 6;8(1):15. doi: 10.1038/s42003-024-07424-7. 10.1038/s42003-024-07424-7 PubMed 39762627