Skip to main content

AAV-DIO-SPOTlight-U2GCR
(Plasmid #231889)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 231889 Standard format: Plasmid sent in bacteria as agar stab 1 $89

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.
  • Serotype
    Select serotype for details
  • Pricing
    Select serotype and quantity
  • How this works
    • Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
    • Addgene will quickly confirm that we can produce a high-quality prep for you.
    • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
    • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
    • Learn more about our Packaged on Request Service.

Backbone

  • Vector backbone
    AAV
  • Backbone size w/o insert (bp) 7076
  • Total vector size (bp) 3175
  • Vector type
    Mammalian Expression, AAV, Cre/Lox

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    DIO-SPOTlight-U2GCR
  • Alt name
    ISR state-dependent protein synthesis reporter (Cre-dependent)
  • Insert Size (bp)
    3079
  • Promoter CAG

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer TCCTTGAAGAAGATGGTGCG
  • 3′ sequencing primer TCACTTGTTCCTAGGACACGG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    VectorBuilder, synthesized AAV-DIO-SPOTlight-U2GCR from sequences originally cloned in the Calakos Lab.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://doi.org/10.1101/2024.10.14.618312 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AAV-DIO-SPOTlight-U2GCR was a gift from Nicole Calakos (Addgene plasmid # 231889 ; http://n2t.net/addgene:231889 ; RRID:Addgene_231889)
  • For your References section:

    DIO-SPOTlight Transgenic Mouse to Functionally Monitor Protein Synthesis Regulated by the Integrated Stress Response. Oliver ML, Caffall ZF, Eatman CB, Faw TD, Calakos N. eLife 2025 14:RP104457 10.7554/eLife.104457.1