AAV-DIO-SPOTlight-U2GCR
(Plasmid
#231889)
-
PurposeCre-dependent reporter to measure ISR state-dependent protein synthesis
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 231889 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $32 USD for plasmid.
-
How this works
- Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backboneAAV
- Backbone size w/o insert (bp) 7076
- Total vector size (bp) 3175
-
Vector typeMammalian Expression, AAV, Cre/Lox
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameDIO-SPOTlight-U2GCR
-
Alt nameISR state-dependent protein synthesis reporter (Cre-dependent)
-
Insert Size (bp)3079
- Promoter CAG
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer TCCTTGAAGAAGATGGTGCG
- 3′ sequencing primer TCACTTGTTCCTAGGACACGG
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byVectorBuilder, synthesized AAV-DIO-SPOTlight-U2GCR from sequences originally cloned in the Calakos Lab.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2024.10.14.618312 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AAV-DIO-SPOTlight-U2GCR was a gift from Nicole Calakos (Addgene plasmid # 231889 ; http://n2t.net/addgene:231889 ; RRID:Addgene_231889) -
For your References section:
DIO-SPOTlight Transgenic Mouse to Functionally Monitor Protein Synthesis Regulated by the Integrated Stress Response. Oliver ML, Caffall ZF, Eatman CB, Faw TD, Calakos N. eLife 2025 14:RP104457 10.7554/eLife.104457.1