MB 94C thsS(t3)R-Bxb1_P7-sfGFP_mCherry
(Plasmid
#232471)
-
PurposeOptimized thiosulfate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherry
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 232471 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepBAD33
-
Backbone manufacturerBeckwith Lab
- Backbone size w/o insert (bp) 5352
- Total vector size (bp) 12309
-
Modifications to backbonepoint mutations introduced during cloning
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert 1
-
Gene/Insert namethsS(t3)
-
Alt nameThiosulfate sensor kinase thsS (Shal_3128) with mutations to enhance performance at 37°C
-
SpeciesShewanella halifaxensis HAW‐EB4
-
Insert Size (bp)1785
-
MutationContains the following mutations K286Q, Q350H, I553V, and F565I, as well as silent point mutations in H51 and S338
-
GenBank IDNC_010334
- Promoter J23104 (ttgacagctagctcagtcctaggtattgtgctagc)
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer ATGTTAGTTACTAAAGGATGACGC
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namethsR
-
Alt nameThiosulfate response regulator thsR (Shal_3129)
-
SpeciesShewanella halifaxensis HAW‐EB4
-
Insert Size (bp)612
-
GenBank IDNC_010334
- Promoter J23105 (TTTACGGCTAGCTCAGTCCTAGGTACTATGCTAGC)
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer AACGCGGTTCTGAAGTGCCG
- (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert namePphsA342
-
Alt nameThiosulfate activated promoter
-
Alt namePromoter of phsA (Shal_3127)
-
SpeciesShewanella halifaxensis HAW‐EB4
-
Insert Size (bp)342
-
GenBank IDNC_010334
Cloning Information for Gene/Insert 3
- Cloning method Gibson Cloning
- 5′ sequencing primer CTGCATAATTCGTGTCGCTC
- (Common Sequencing Primers)
Gene/Insert 4
-
Gene/Insert namesfGFP
-
Alt namesuperfolder GFP
-
SpeciesSynthetic
-
Insert Size (bp)720
-
GenBank ID
- Promoter P7 (aaaaaatttatttgctttcgcatctttttgtacctataatgtgtgga)
Cloning Information for Gene/Insert 4
- Cloning method Gibson Cloning
- 5′ sequencing primer GATTACTTCGCGTTTGCCAC
- (Common Sequencing Primers)
Gene/Insert 5
-
Gene/Insert nameAxeTxe
-
Alt nameToxin-antitoxin system
-
SpeciesEnterococcus faecium
-
Insert Size (bp)1212
-
GenBank IDAF507977.1
- Promoter Native
Cloning Information for Gene/Insert 5
- Cloning method Gibson Cloning
- 5′ sequencing primer AGGCGGGACATGATCTATAGG
- (Common Sequencing Primers)
Gene/Insert 6
-
Gene/Insert namemCherry
-
SpeciesSynthetic
- Promoter J23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC)
Cloning Information for Gene/Insert 6
- Cloning method Gibson Cloning
- 5′ sequencing primer CGGTTCAAAGAGTTGGTAGC
- (Common Sequencing Primers)
Gene/Insert 7
-
Gene/Insert nameBxb1 integrase
-
SpeciesMycobacterium phage Bxb1
-
Insert Size (bp)1542
-
GenBank IDNC_002656
- Promoter PphsA342
-
Tag
/ Fusion Protein
- ssrA degradation tag (C terminal on insert)
Cloning Information for Gene/Insert 7
- Cloning method Gibson Cloning
- 5′ sequencing primer CTGCATAATTCGTGTCGCTC
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2024.09.23.614598 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
MB 94C thsS(t3)R-Bxb1_P7-sfGFP_mCherry was a gift from Mikhail Shapiro (Addgene plasmid # 232471 ; http://n2t.net/addgene:232471 ; RRID:Addgene_232471) -
For your References section:
Probiotic acoustic biosensors for noninvasive imaging of gut inflammation. Buss MT, Zhu L, Kwon JH, Tabor JJ, Shapiro MG. Nat Commun. 2025 Aug 25;16(1):7931. doi: 10.1038/s41467-025-62569-1. 10.1038/s41467-025-62569-1 PubMed 40855083