MB 103C ttrSR(m13)-Bxb1_P7-sfGFP_mCherry
(Plasmid
#232475)
-
PurposeOptimized tetrathionate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherry
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 232475 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepBAD33
-
Backbone manufacturerBeckwith Lab
- Backbone size w/o insert (bp) 5352
- Total vector size (bp) 12295
-
Modifications to backbonepoint mutations introduced during cloning
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert 1
-
Gene/Insert namettrS
-
Alt nameTetrathionate sensor kinase ttrS (Sbal195_3859)
-
SpeciesShewanella baltica OS195
-
Insert Size (bp)2016
-
GenBank IDNC_009997
- Promoter J23109 (tttacagctagctcagtcctagggactgtgctagc)
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer ATGTTAGTTACTAAAGGATGACGC
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namettrR
-
Alt nameTetrathionate response regulator ttrR (Sbal195_3858)
-
SpeciesShewanella baltica OS195
-
Insert Size (bp)621
-
GenBank IDNC_009997
- Promoter Constitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC)
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer TATCGCTGAGTCCCACGGTG
- (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert namePttrB185-269
-
Alt nameMinimal tetrathionate activated promoter
-
Alt nameTruncated promoter of ttrB (Sbal195_3860)
-
SpeciesShewanella baltica OS195
-
Insert Size (bp)85
-
GenBank IDNC_009997
Cloning Information for Gene/Insert 3
- Cloning method Gibson Cloning
- 5′ sequencing primer CTGCATAATTCGTGTCGCTC
- (Common Sequencing Primers)
Gene/Insert 4
-
Gene/Insert namesfGFP
-
Alt namesuperfolder GFP
-
SpeciesSynthetic
-
Insert Size (bp)720
-
GenBank ID
- Promoter P7 (aaaaaatttatttgctttcgcatctttttgtacctataatgtgtgga)
Cloning Information for Gene/Insert 4
- Cloning method Gibson Cloning
- 5′ sequencing primer GATTACTTCGCGTTTGCCACC
- (Common Sequencing Primers)
Gene/Insert 5
-
Gene/Insert nameAxeTxe
-
Alt nameToxin-antitoxin system
-
SpeciesEnterococcus faecium
-
Insert Size (bp)1212
-
GenBank IDAF507977.1
- Promoter Native
Cloning Information for Gene/Insert 5
- Cloning method Gibson Cloning
- 5′ sequencing primer CCGCTAATTAACTAAAACTAGTAC
- (Common Sequencing Primers)
Gene/Insert 6
-
Gene/Insert namemCherry
-
SpeciesSynthetic
-
Insert Size (bp)711
- Promoter J23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC)
Cloning Information for Gene/Insert 6
- Cloning method Gibson Cloning
- 5′ sequencing primer GTTTTCAGAGCAAGAGATTACG
- (Common Sequencing Primers)
Gene/Insert 7
-
Gene/Insert nameBxb1 integrase
-
SpeciesMycobacterium phage Bxb1
-
Insert Size (bp)1542
-
GenBank IDNC_002656
- Promoter PttrB185-269
-
Tag
/ Fusion Protein
- ssrA degradation tag (C terminal on insert)
Cloning Information for Gene/Insert 7
- Cloning method Gibson Cloning
- 5′ sequencing primer CTGCATAATTCGTGTCGCTC
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2024.09.23.614598 for bioRxiv preprint.
Please note: This plasmid contains a R11S mutation in Bxb1 integrase. This mutation is not known to impact plasmid function.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
MB 103C ttrSR(m13)-Bxb1_P7-sfGFP_mCherry was a gift from Mikhail Shapiro (Addgene plasmid # 232475 ; http://n2t.net/addgene:232475 ; RRID:Addgene_232475) -
For your References section:
Probiotic acoustic biosensors for noninvasive imaging of gut inflammation. Buss MT, Zhu L, Kwon JH, Tabor JJ, Shapiro MG. Nat Commun. 2025 Aug 25;16(1):7931. doi: 10.1038/s41467-025-62569-1. 10.1038/s41467-025-62569-1 PubMed 40855083