Skip to main content

pAAV-hSyn-PinkyCaMP
(Plasmid #232856)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 232856 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pAAV-hSyn
  • Backbone size w/o insert (bp) 4367
  • Total vector size (bp) 5793
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    PinkyCaMP
  • Species
    Synthetic
  • Insert Size (bp)
    1425
  • Promoter hSyn

Cloning Information

  • Cloning method Other
  • 5′ sequencing primer CACTGAAGGCGCGCTGAC
  • 3′ sequencing primer CCACATAGCGTAAAAGGAGC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://doi.org/10.1101/2024.12.16.628673 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-hSyn-PinkyCaMP was a gift from Olivia Masseck (Addgene plasmid # 232856 ; http://n2t.net/addgene:232856 ; RRID:Addgene_232856)
  • For your References section:

    PinkyCaMP a mScarlet-based calcium sensor with exceptional brightness, photostability, and multiplexing capabilities. Fink R, Imai S, Gockel N, Lauer G, Renken K, Wietek J, Lamothe-Molina PJ, Furhmann F, Mittag M, Ziebarth T, Canziani A, Kubitschke M, Kistmacher V, Kretschmer A, Sebastian E, Schmitz D, Terai T, Grundemann J, Hassan S, Patriarchi T, Reiner A, Fuhrmann M, Campbell RE, Masseck OA. bioRxiv [Preprint]. 2025 Jan 11:2024.12.16.628673. doi: 10.1101/2024.12.16.628673. 10.1101/2024.12.16.628673 PubMed 39763884