pPB-CAG-dCas9-VPR-pgk-hph
(Plasmid
#233066)
-
PurposePiggybac CRISPRa construct
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 233066 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepPB-CAG-3xFLAG-empty-pgk-hph
-
Vector typeCRISPR
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namedCas9-VPR
Cloning Information
- Cloning method Gene Synthesis
- 5′ sequencing primer ctacagctcctgggcaacgtgctg
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byAddgene #48754
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2024.09.12.612198 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pPB-CAG-dCas9-VPR-pgk-hph was a gift from Markus Landthaler (Addgene plasmid # 233066 ; http://n2t.net/addgene:233066 ; RRID:Addgene_233066) -
For your References section:
Sensitive dissection of a genomic regulatory landscape using bulk and targeted single-cell activation. Vucicevic D, Hsu CW, Lopez Zepeda LS, Burkert M, Hirsekorn A, Bilic I, Kastelic N, Landthaler M, Lacadie SA, Ohler U. Cell Genom. 2025 Oct 8;5(10):100984. doi: 10.1016/j.xgen.2025.100984. Epub 2025 Sep 9. 10.1016/j.xgen.2025.100984 PubMed 40930101