pU6-sgRNA-S1b (BsaI)-CBh-eCas12f1a
(Plasmid
#233079)
-
PurposeExpression vector for sgRNA-S1b and eCas12f1a
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 233079 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonePX458
-
Backbone manufacturerFeng Zhang Lab
- Backbone size w/o insert (bp) 2978
- Total vector size (bp) 8937
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameU6-sgRNA-S1b (BsaI)-Cbh-bpNLS-eCas12f1a-2xFLAG-P2A-EGFP
-
SpeciesSynthetic
-
Insert Size (bp)5959
- Promoter hU6, CBh
-
Tag
/ Fusion Protein
- 2xFLAG
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GAGGGCCTATTTCCCATGATT
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pU6-sgRNA-S1b (BsaI)-CBh-eCas12f1a was a gift from Kyoungmi Kim (Addgene plasmid # 233079 ; http://n2t.net/addgene:233079 ; RRID:Addgene_233079) -
For your References section:
Robust genome editing activity and the applications of enhanced miniature CRISPR-Cas12f1. Park SJ, Ju S, Jung WJ, Jeong TY, Yoon DE, Lee JH, Yang J, Lee H, Choi J, Kim HS, Kim K. Nat Commun. 2025 Jan 15;16(1):677. doi: 10.1038/s41467-025-56048-w. 10.1038/s41467-025-56048-w PubMed 39809780