pCIFR-3
(Plasmid
#233295)
-
PurposeIntegration of msfGFP (or your Module Of Interest) in a random fashion via Tn5 insertion. The antibiotic cassette used for selecting for the integration can be removed in a later stage with pFNC.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 233295 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepBAMD1-2
- Backbone size w/o insert (bp) 4623
- Total vector size (bp) 5466
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Pir1
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namemsfGFP
-
Alt namemonomeric superfolder GFP
-
SpeciesSynthetic
-
Insert Size (bp)717
- Promoter p14G
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer AGCCTTTCGTTTTATTTGATGCCTTTAATTAA
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCIFR-3 was a gift from Pablo Ivan Nikel (Addgene plasmid # 233295 ; http://n2t.net/addgene:233295 ; RRID:Addgene_233295) -
For your References section:
CIFR (Clone-Integrate-Flip-out-Repeat): A toolset for iterative genome and pathway engineering of Gram-negative bacteria. Federici F, Luppino F, Aguilar-Vilar C, Mazaraki ME, Petersen LB, Ahonen L, Nikel PI. Metab Eng. 2025 Jan 6;88:180-195. doi: 10.1016/j.ymben.2025.01.001. 10.1016/j.ymben.2025.01.001 PubMed 39778677