pDisplay-CMV-GRAB_LoX3-mut
(Plasmid
#234651)
-
PurposeThis plasmid encodes a mutated version of the genetically encoded chemokine biosensor LoX3-1.0, which is designed to be non-responsive to chemokine binding.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 234651 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepDisplay
- Backbone size w/o insert (bp) 6546
- Total vector size (bp) 8631
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGPCR activation-based mutant chemokine CXCL9-11 sensor GRAB_LoX3-mut
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2085
- Promoter CMV
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ATGGGCGGTAGGCGTGTA
- 3′ sequencing primer GGTTGTGGCCATATTATCATC
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDisplay-CMV-GRAB_LoX3-mut was a gift from Miao Jing (Addgene plasmid # 234651 ; http://n2t.net/addgene:234651 ; RRID:Addgene_234651) -
For your References section:
Spatiotemporal dynamics of CXCL10 encode contextual immune information revealed by the genetically encoded fluorescent sensor. Xi F, Wang C, Wang Y, Luan P, Chen Y, Tan L, Shang N, Gao X, Chen D, Guo Q, Chen T, Jing M. Immunity. 2025 Sep 9;58(9):2320-2335.e9. doi: 10.1016/j.immuni.2025.07.005. Epub 2025 Aug 15. 10.1016/j.immuni.2025.07.005 PubMed 40818452