PGK-HA-PGRN-LAMP1TM
(Plasmid #234873)

• Purpose: Lentiviral plasmid expressing HA-tagged human progranulin that is fused to the transmembrane domain and cytosolic tail of LAMP-1. Enables lysosomal delivery of progranulin without secretion.
• Depositing Lab: Andrew Arrant
• Publication: Davis et al J Biol Chem. 2021 Sep;297(3):100993. doi: 10.1016/j.jbc.2021.100993. Epub 2021 Jul 21.

Backbone

• Vector backbone: pRRLSIN.cPPT.PGK-GFP.WPRE
• Backbone manufacturer: Didier Trono (Addgene #12252)
• Backbone size w/o insert (bp): 6655
• Total vector size (bp): 8584
• Vector type: Mammalian Expression, Lentiviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Progranulin
• Species: H. sapiens (human)
• Insert Size (bp): 1929
• Entrez Gene: GRN (a.k.a. CLN11, FTD2, GEP, GP88, PCDGF, PEPI, PGRN)
• Promoter: PGK
• Tags / Fusion Proteins:
  • HA tag (N terminal on insert)
  • LAMP-1 transmembrane domain and cytosolic tail (C terminal on insert)

Cloning Information

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: gggtgtggggcggtagtg
• 3′ sequencing primer: cataaagagacagcaaccagga

Resource Information

• Supplemental Documents:
  • pRRL with GRN LAMP1 fusion.gb
• A portion of this plasmid was derived from a plasmid made by: OriGene Technologies (human GRN plasmid) and IDT (LAMP-1 TM obtained as G block)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry