FUGW U6 gLacZ dCas9-KRAB-T2a-GFP
(Plasmid
#234883)
-
Purposenon-targeting CRISPRi control
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 234883 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLV hU6-sgRNA hUbC-dCas9-KRAB-T2a-GFP
-
Vector typeMammalian Expression, Lentiviral, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameL1HS gRNA
-
gRNA/shRNA sequenceGTCTTCTGCGTCGCTCACGC
-
SpeciesH. sapiens (human)
-
Tag
/ Fusion Protein
- GFP
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsmBI (destroyed during cloning)
- 3′ cloning site BsmBI (destroyed during cloning)
- 5′ sequencing primer gagggcctatttcccatgattcc
- (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2025.01.17.633315 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
FUGW U6 gLacZ dCas9-KRAB-T2a-GFP was a gift from Johan Jakobsson (Addgene plasmid # 234883 ; http://n2t.net/addgene:234883 ; RRID:Addgene_234883) -
For your References section:
LINE-1 retrotransposons regulate the exit of human pluripotency and early brain development. Adami A, Garza R, Gerdes P, Johansson PA, Dorazehi F, Koutounidou S, Castilla-Vallmanya L, Atacho DAM, Sharma Y, Johansson JG, Tam O, Kirkeby A, Barker RA, Gale-Hammell M, Douse CH, Jakobsson J. bioRxiv 2025.01.17.633315 10.1101/2025.01.17.633315