pBTK1126
(Plasmid
#236187)
-
PurposeBsaI compatible gentamicin resistance cassette
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 236187 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepBTK1001
- Backbone size w/o insert (bp) 2824
- Total vector size (bp) 2778
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol and Gentamicin, 25 & 10 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namegentamicin resistance cassette
-
SpeciesSynthetic
-
Insert Size (bp)947
- Promoter CP25
Cloning Information
- Cloning method Golden Gate
- 5′ sequencing primer gtcttaagttttttggctgaaagtc
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBTK1126 was a gift from Jeffrey Barrick (Addgene plasmid # 236187 ; http://n2t.net/addgene:236187 ; RRID:Addgene_236187) -
For your References section:
UltraCAST: A Flexible All-In-One Suicide Vector for Modifying Bacterial Genomes Using a CRISPR-Associated Transposon. VanDieren AJ, Barrick JE. MicroPubl Biol. 2025 Aug 2;2025:10.17912/micropub.biology.001721. doi: 10.17912/micropub.biology.001721. eCollection 2025. 10.17912/micropub.biology.001721 PubMed 40827214