pAG GST Empty
(Plasmid
#236735)
-
Purpose(Empty Backbone) Empty bacterial expression plasmid for GST fusion proteins
-
Depositing Labs
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 236735 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 * |
* Log in to view industry pricing.
Backbone
-
Vector backbonepAG
-
Backbone manufacturerAddgene
- Backbone size (bp) 4296
-
Vector typeBacterial Expression
-
Tag
/ Fusion Protein
- GST (N terminal on insert)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GAGCGGATAACAATTTCACACAGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAG GST Empty was a gift from Melina Fan & Addgene Research Program (Addgene plasmid # 236735 ; http://n2t.net/addgene:236735 ; RRID:Addgene_236735)