pGP-pcDNA3.1 Puro-CAG-Positron2
(Plasmid
#239079)
-
PurposeMammalian expression of positive-going voltage sensor
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 239079 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepcDNA3.1
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePositron2
-
Alt namePositron2 insert
-
Alt namevariant 421.6237
-
SpeciesSynthetic
-
Insert Size (bp)1659
-
MutationR78K N81D D92N W178F
- Promoter CAG
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GGTTCGGCTTCTGGCGTGTGACC
- 3′ sequencing primer TTAAAGCAGCGTATCCACAT
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGP-pcDNA3.1 Puro-CAG-Positron2 was a gift from GENIE Project (Addgene plasmid # 239079 ; http://n2t.net/addgene:239079 ; RRID:Addgene_239079) -
For your References section:
Optimization of Ace2N based voltage indicators. Eric R. Schreiter, Ahmed Abdelfattah, Jeremy Hasseman, Daniel Reep, Getahun Tsegaye, Arthur Tsang, Ilya Kolb, Allan Wong, Amy Chuong, Jihong Zheng, Ben Arthur, Wyatt Korff, GENIE Project Team. Janelia Figshare 2023 10.25378/janelia.22325446.v1