pLP17_Lenti α-syn
(Plasmid #239419)

• Purpose: Lentiviral plasmid for SpCas9-based CRISPR KO of mouse α-syn
• Depositing Lab: Subhojit Roy
• Publication: Parra-Rivas et al STAR Protoc. 2025 Jul 21;6(3):103945. doi: 10.1016/j.xpro.2025.103945.

Want a viral vector made from this plasmid?

Make a packaging request and we'll get back to you.

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.

• Serotype: Select serotype for details See details about
• Pricing: Select serotype and quantity $ USD for preparation of µL virus + $32 USD for plasmid.
• How this works:
  • Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
  • Addgene will quickly confirm that we can produce a high-quality prep for you.
  • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
  • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
  • Learn more about our Packaged on Request Service.

Backbone

• Vector backbone: lentiCRISPR v2 (Plasmid #52961)
• Vector type: Lentiviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: mouse a-synuclein sgRNA
• gRNA/shRNA sequence: GTTCATGAAAGGACTTTCAA
• Species: M. musculus (mouse)
• Insert Size (bp): 21
• Entrez Gene: Snca (a.k.a. NACP, alpha-Syn, alphaSYN)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry