Skip to main content

pLP17_Lenti α-syn
(Plasmid #239419)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 239419 Standard format: Plasmid sent in bacteria as agar stab 1 $89

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.
  • Serotype
    Select serotype for details
  • Pricing
    Select serotype and quantity
  • How this works
    • Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
    • Addgene will quickly confirm that we can produce a high-quality prep for you.
    • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
    • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
    • Learn more about our Packaged on Request Service.

Backbone

  • Vector backbone
    lentiCRISPR v2 (Plasmid #52961)
  • Vector type
    Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    mouse a-synuclein sgRNA
  • gRNA/shRNA sequence
    GTTCATGAAAGGACTTTCAA
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    21
  • Entrez Gene
    Snca (a.k.a. NACP, alpha-Syn, alphaSYN)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLP17_Lenti α-syn was a gift from Subhojit Roy (Addgene plasmid # 239419 ; http://n2t.net/addgene:239419 ; RRID:Addgene_239419)
  • For your References section:

    Protocol for CRISPR-based manipulation and visualization of endogenous alpha-synuclein in cultured mouse hippocampal neurons. Parra-Rivas LA, Sharma R, Rust TE, Bazick HO, Carlson-Stevermer J, Zylka MJ, Ogawa Y, Roy S. STAR Protoc. 2025 Jul 21;6(3):103945. doi: 10.1016/j.xpro.2025.103945. 10.1016/j.xpro.2025.103945 PubMed 40700012