pHIV-IL13-IgG4hinge-PDGFR
(Plasmid
#240245)
-
PurposeLentiviral transfer plasmid encoding IL13 with IgG4 hinge and PDGFR TM domain
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 240245 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepHIV
- Total vector size (bp) 8899
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameIL-13
-
SpeciesH. sapiens (human)
-
Insert Size (bp)663
-
GenBank ID3596
-
Entrez GeneIL13 (a.k.a. IL-13, P600)
- Promoter EF1a
-
Tags
/ Fusion Proteins
- HA (C terminal on insert)
- EGFP (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer AGCGGCCGCTGAGTTAACTATTCTAGA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHIV-IL13-IgG4hinge-PDGFR was a gift from Michael Birnbaum (Addgene plasmid # 240245 ; http://n2t.net/addgene:240245 ; RRID:Addgene_240245) -
For your References section:
Antigen identification and high-throughput interaction mapping by reprogramming viral entry. Dobson CS, Reich AN, Gaglione S, Smith BE, Kim EJ, Dong J, Ronsard L, Okonkwo V, Lingwood D, Dougan M, Dougan SK, Birnbaum ME. Nat Methods. 2022 Apr;19(4):449-460. doi: 10.1038/s41592-022-01436-z. Epub 2022 Apr 8. 10.1038/s41592-022-01436-z PubMed 35396484