LAMP1-G-GECO1.2
(Plasmid
#240467)
-
PurposeMid-affinity GECI targeted to cytosolic face of the lysosome
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 240467 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepDendra2-N
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 3964
- Total vector size (bp) 6508
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameLAMP1
-
Alt nameLysosome associated membrane protein 1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1251
-
MutationSilent mutation
-
GenBank ID3916
-
Entrez GeneLAMP1 (a.k.a. CD107a, LAMPA, LGP120)
- Promoter CMV
-
Tag
/ Fusion Protein
- G-GECO1.2 (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (unknown if destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer CAA CGG GAC TTT CCA AAA TG
- 3′ sequencing primer GAAATTTGTGATGCTATTGC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
LAMP1-G-GECO1.2 was a gift from Antony Galione (Addgene plasmid # 240467 ; http://n2t.net/addgene:240467 ; RRID:Addgene_240467) -
For your References section:
Optical profiling of autonomous Ca(2+) nanodomains generated by lysosomal TPC2 and TRPML1. Davis LC, Morgan AJ, Galione A. Cell Calcium. 2023 Dec;116:102801. doi: 10.1016/j.ceca.2023.102801. Epub 2023 Sep 18. 10.1016/j.ceca.2023.102801 PubMed 37742482