tetO-HyperTRIBE-adar_deaminase-V5-t2a-mCherry
(Plasmid
#241314)
-
Purposeinducible mouse Adar Deaminase domain (HyperTRIBE) for expression in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 241314 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepTRE2
- Total vector size (bp) 5769
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameAdar deaminase domain
-
SpeciesM. musculus (mouse)
-
MutationE957Q
-
Entrez GeneAdar (a.k.a. Adar1, Adar1p110, Adar1p150, DRADA, mZaADAR)
- Promoter tetO and CMV
-
Tag
/ Fusion Protein
- V5 (C terminal on insert)
Cloning Information
- Cloning method Other
- 5′ sequencing primer pTRE2-Seq_Fwd: AATTCGAGCTCGGTACCCGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The "HyperTRIBE" mutation is E488Q in drosophila and is conserved at the E957Q amino acid in the mouse Adar gene (amino acid references transcript uc008pzx.2, which is 1178 amino acids in length). This insert is a C-terminal truncation of the total Adar gene from T788 to F1170 - which spans the deaminase domain.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
tetO-HyperTRIBE-adar_deaminase-V5-t2a-mCherry was a gift from Stavros Lomvardas (Addgene plasmid # 241314 ; http://n2t.net/addgene:241314 ; RRID:Addgene_241314)